View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5247_high_3 (Length: 569)
Name: NF5247_high_3
Description: NF5247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5247_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 4715393 - 4715451
Alignment:
| Q |
12 |
catcatcagtagcttttatattattggtggagccatagattgtggtggcaataaaattt |
70 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4715393 |
catcatgagtagcttttatattattggtggagccatagattgtggtggcaataaaattt |
4715451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 122 - 159
Target Start/End: Complemental strand, 41043253 - 41043216
Alignment:
| Q |
122 |
caagctgccattgactctataaagagtcaaaatgatca |
159 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
41043253 |
caagctgccattgattctataaagagtcaaaataatca |
41043216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University