View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5247_low_15 (Length: 277)
Name: NF5247_low_15
Description: NF5247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5247_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 45 - 231
Target Start/End: Original strand, 32515821 - 32516007
Alignment:
| Q |
45 |
atatctaattctaataaggtgcaatatatggtaggtgcaaaatccaaccaaacatagcgcatgaatgtgaaaattcaggtaacgaatcttatcaaagaga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515821 |
atatctaattctaataaggtgcaatatatggtaggtacaaaatccaaccaaacatagcgcatgaatgtgaaaattcaggtaacgaatcttatcaaagaga |
32515920 |
T |
 |
| Q |
145 |
ccttgatgaaagccttatatattgtgtatctaacaaaatcttaagctccttacatagcaaacaaaattttgatgtcacactttactc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515921 |
ccttgatgaaagccttatatattgtgtatctaacaaaatcttaagctccttacatagcaaacaaaattttgatgtcacactttactc |
32516007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University