View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5247_low_22 (Length: 250)
Name: NF5247_low_22
Description: NF5247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5247_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 38475987 - 38475928
Alignment:
| Q |
48 |
tgttctgaaattgttaaataatcaactcattatcaaccattttgaacacatctctctcaa |
107 |
Q |
| |
|
|||| |||||| ||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38475987 |
tgttatgaaatcgttgaataatcaactcattatcaacctttttgaacacatctctctcaa |
38475928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 36 - 107
Target Start/End: Original strand, 30866256 - 30866328
Alignment:
| Q |
36 |
tacgagcttttttgttctgaaattg-ttaaataatcaactcattatcaaccattttgaacacatctctctcaa |
107 |
Q |
| |
|
|||||| ||| ||||||||||||| || ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30866256 |
tacgaggtttcttgttctgaaatttattgaataatcaattcattatcaacttttttgaacacatctctctcaa |
30866328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 198 - 245
Target Start/End: Complemental strand, 33304759 - 33304712
Alignment:
| Q |
198 |
tatatccttccttcatcgataagctcatcacatatactgatgcagact |
245 |
Q |
| |
|
|||||||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
33304759 |
tatatccttcctcaattgataagctcatcacctatactgatgcagact |
33304712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 243
Target Start/End: Original strand, 23281302 - 23281345
Alignment:
| Q |
200 |
tatccttccttcatcgataagctcatcacatatactgatgcaga |
243 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
23281302 |
tatccttccttcattgataagctcatcacttatactgatgcaga |
23281345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 198 - 243
Target Start/End: Complemental strand, 25160810 - 25160765
Alignment:
| Q |
198 |
tatatccttccttcatcgataagctcatcacatatactgatgcaga |
243 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
25160810 |
tatatccttcctccatttataagctcatcacatatactgatgcaga |
25160765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 107
Target Start/End: Original strand, 32797809 - 32797861
Alignment:
| Q |
55 |
aaattgttaaataatcaactcattatcaaccattttgaacacatctctctcaa |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | | ||||||||||||||||| |
|
|
| T |
32797809 |
aaattgttaaataatcaattcattatcaactttgtcgaacacatctctctcaa |
32797861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University