View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5247_low_33 (Length: 205)
Name: NF5247_low_33
Description: NF5247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5247_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 190
Target Start/End: Original strand, 13225857 - 13226039
Alignment:
| Q |
8 |
tggaacaattccatcaagcttcaacaattgttcaactctcgaaaatttcaacatcagtttcaattcccttaccggagcaatcccttcctccggtgtcttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13225857 |
tggaacaattccatcaagcttcaacaattgctcaactctcgaaaatttcaacatcagtttcaattcccttaccggagcaatcccttcctccggcgtcttc |
13225956 |
T |
|
| Q |
108 |
caaagcctccatccttcttcctactccggcaatgaaaatctctgtggtgttctcttagccaaaccctgcgccgatgaagcagt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13225957 |
caaagcctccatccttcttcctactccggcaatgaaaatctctgtggtgttctcttagccaaaccctgcgccgatgaagcagt |
13226039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University