View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5248-Insertion-8 (Length: 58)
Name: NF5248-Insertion-8
Description: NF5248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5248-Insertion-8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 44; Significance: 7e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 24650016 - 24650063
Alignment:
| Q |
8 |
aatatgttaatgtatttgagtttagtcacttggcatgtgtgatttatt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24650016 |
aatatgttaatgtatttgagtttagtcacttggtatgtgtgatttatt |
24650063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 24656490 - 24656540
Alignment:
| Q |
8 |
aatatgttaatgtatttgagtttagtcacttggcatgtgtgatttattggt |
58 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||| ||||||||| |
|
|
| T |
24656490 |
aatatgttaatgtattttagtttagtcacttagcttgtgtgctttattggt |
24656540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University