View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5248_high_5 (Length: 364)
Name: NF5248_high_5
Description: NF5248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5248_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 361
Target Start/End: Original strand, 53053595 - 53053955
Alignment:
| Q |
1 |
atttgtcacgtctcctgccactcttagacttttcttccatgattgttttgttagggtatgtgtgtaatttacttctcatttcattattttcttattaatt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53053595 |
atttgtcactgctcctgccactcttagacttttcttccatgattgttttgtcagggtatgtctgtaatttacttctcatttcattattttcttattaatt |
53053694 |
T |
 |
| Q |
101 |
aaactctaatgagaaatttgtgcatgtttatatgctaaatagatacttgcttttatagggttgtgatgcttcgattttgcttgcaactccgaaggcagag |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53053695 |
aaacattaatgagaaatttgtgcatgtttatatgctaaatagatacttgcttttacagggttgtgatgcttcgattttgcttgcaactccgaaggcagag |
53053794 |
T |
 |
| Q |
201 |
agggaacatcctgatgatatatcactagctggtgacggttttgacacggtggttaaggccaaggcagcagttgatagggatcctaaatgccgaaacaaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53053795 |
agggaacatcctgatgatatatcactagctggtgatggttttgacacggtggttaaggccaaggcagcagttgatagggatcctaaatgccgaaacaaag |
53053894 |
T |
 |
| Q |
301 |
tctcttgtgctgatattctcgctctcgcaactagggatgttgtcaatttggtaccattcat |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53053895 |
tctcttgtgctgatattctcgctctcgcaactagggatgttgtcaatttggtaccattcat |
53053955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University