View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5249-Insertion-6 (Length: 243)
Name: NF5249-Insertion-6
Description: NF5249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5249-Insertion-6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 243
Target Start/End: Original strand, 29935886 - 29936140
Alignment:
| Q |
8 |
atttatacaaggaacaaatttaggagtgtgtattaataatttaacatatagttttcgtattcaactttgtatttgc--------------------aaga |
87 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29935886 |
atttatacaagcaacaaatttaggagtgtgtattaataatttaacatatagttttcgtattcaactttgtatttgccacaaggacaaggtaactccaaga |
29935985 |
T |
 |
| Q |
88 |
agaaaggtcgaggaaggtttcatgtggttttgttactttagatgttaaattattgaattgaatttgcatctgtggttgttgattagttgccacaaagttg |
187 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29935986 |
agaaaggtcgtggaaggtttcatgtggttttgttactttagatgttaaattattgaattgaatttgcatcagtggttgttgattagttgccacaaagttg |
29936085 |
T |
 |
| Q |
188 |
gaatttgaatatgttcagtcaacgttgccactaaggcttttgtggacttttcacct |
243 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29936086 |
gaa-ttgaatatgttcagtcagcgttgccactaaggcttttgtggacttttcacct |
29936140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University