View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5249-Insertion-9 (Length: 98)
Name: NF5249-Insertion-9
Description: NF5249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5249-Insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 4065869 - 4065785
Alignment:
| Q |
8 |
caaccgataaaacagagttaatgtaaacttttctggacacggtactctagtcccatagacaattcagcataattacacatcaaat |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065869 |
caaccgataaaacagagttaatgtaaacttttctggacatagtactctagtcccatagacaattcagcataattacacatcaaat |
4065785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University