View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5249_low_5 (Length: 310)
Name: NF5249_low_5
Description: NF5249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5249_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 84 - 204
Target Start/End: Original strand, 9141461 - 9141584
Alignment:
| Q |
84 |
tattaataagccaaacggtggtgaagctttttatgttaatatgttctcaaattctcaaaat---tnnnnnnnnnnnntgaattgttctttcttcttaact |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9141461 |
tattaataagccaaacggtggtgaagctttttatgttaatatgttctcaaattctcaaaataaaaaaataaaaaaaatgaattgttctttcttcttaact |
9141560 |
T |
|
| Q |
181 |
gaataaacagcgcacgaagattcc |
204 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9141561 |
gaataaacagcgcacgaagattcc |
9141584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 9141391 - 9141431
Alignment:
| Q |
17 |
agaagacgggtgttgggaatgaaatgcgaactctactgaac |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9141391 |
agaagacgggtgttgggaatgaaatgcgaactctactgaac |
9141431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University