View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5250-Insertion-10 (Length: 160)
Name: NF5250-Insertion-10
Description: NF5250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5250-Insertion-10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 7 - 160
Target Start/End: Original strand, 50958784 - 50958938
Alignment:
| Q |
7 |
ctttccttgctatgattttttattagctaagaaaaatttctcgcaaaaa-ttatttcgcgaatgtatcacaaccgattgaatttgttagttttgtaattg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50958784 |
ctttccttgctatgattttttattagctaagaaaagtttctcgcaaaaaattgtttcgcgaatgtatcacaatcgattgaatttgttagttttgtaattg |
50958883 |
T |
 |
| Q |
106 |
tagcccattgtttccgcaaaatacgtgatacaaagatggcaatccatttgggaca |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50958884 |
tagcccattgtttccgcaaaatacgtgatacaaagatggcaatccatttgggaca |
50958938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University