View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5250-Insertion-12 (Length: 126)
Name: NF5250-Insertion-12
Description: NF5250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5250-Insertion-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 12 - 126
Target Start/End: Complemental strand, 4523325 - 4523211
Alignment:
| Q |
12 |
ggacaaggggagtatttaaatgtgcttgtagcacgtattgctagatttaattgttatattttttggttcacaagggtttgcctttgccgttattcactca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4523325 |
ggacaaggggagtatttaaatgtgcttgtagcacgtattgctagatttagttggtatattttttggttcacaagggtttgcctttgccgttattcactca |
4523226 |
T |
|
| Q |
112 |
atttcgttctgcttg |
126 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4523225 |
atttcgttctgcttg |
4523211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University