View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5250_high_9 (Length: 292)
Name: NF5250_high_9
Description: NF5250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5250_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 46 - 273
Target Start/End: Original strand, 14122194 - 14122420
Alignment:
| Q |
46 |
taatatacaacatcctgggggataaaaacccaaaaatcatgcagaaagtcaaatgttacaaaagttgtattcaacctcgtgtgatttttctaaaatttat |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14122194 |
taatatacaacatcctgggggataaaaaaccaaaa-tcatgcagaaagtcaaatgttacaaaagttgtattcaacctcgtgtgatatttctaaaatttat |
14122292 |
T |
 |
| Q |
146 |
atctaatcggtgtgaagtcagaaacacgttttccttcaaaatctgtgttatcacttgaaattgtgatacaaaagtcttcaatttcatcaccctagtgttt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14122293 |
atctaatcggtgtgaagtcagaaacacgttttccttcaaaatctgtgttatcacttgaagttgtgatacaaaagtcttcaatttcatcaccctagtgttt |
14122392 |
T |
 |
| Q |
246 |
ggtcagatacgtagtgtttggagggagt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14122393 |
ggtcagatacgtagtgtttggagggagt |
14122420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University