View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5250_low_13 (Length: 241)
Name: NF5250_low_13
Description: NF5250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5250_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 224
Target Start/End: Complemental strand, 37827660 - 37827459
Alignment:
| Q |
23 |
ggaagcgttttgtttagctacgaatttgttagttgaggtgtcttgctagggccatgagtagctgatgcaggggcaattaaagtcgtggaaccccccagat |
122 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827660 |
ggaagcgttttgtttagctatgaatttgttagttgaggtgtcttgctagggccatgagtagctgatgcaggggcaattaaagtcgtggaaccccccagat |
37827561 |
T |
 |
| Q |
123 |
ctgcccaaagtcacatgaatattgataaagatataaaagagttggcccttgtcaattcattgttatctagctaggagtggctgcaatgatatgcctccaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827560 |
ctgcccaaagtcacatgaatattgataaagatataaaagagttggcccttgtcaattcattgttatctagctaggagtggctgcaatgatatgcctccaa |
37827461 |
T |
 |
| Q |
223 |
aa |
224 |
Q |
| |
|
|| |
|
|
| T |
37827460 |
aa |
37827459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University