View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5251-Insertion-5 (Length: 244)
Name: NF5251-Insertion-5
Description: NF5251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5251-Insertion-5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 8 - 244
Target Start/End: Original strand, 40801800 - 40802035
Alignment:
| Q |
8 |
ggttattatgataaacttcattgaagctgtttgtacacgaatgtaatgtaagcagtcttgttggctgccccgacgccgatcaaagggtaagatcactggc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40801800 |
ggttattatgataaacttcattgaagctgtttgtac--gaatgtaatgtaaccagtcttgttggctgccccgacgccgatcaaagggtaagatcactagc |
40801897 |
T |
|
| Q |
108 |
tttgctctaatatatataacttatcgatctctctctcatttttaacatcaatataatggacttgga-tctctataacagctgtat-ata-tggtacgtgc |
204 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||| |
|
|
| T |
40801898 |
tttgctctaatatatataacttatcga--tctctctcatttttaacatcaatataatggacttggattctctataacagctgtatggtattggtacgtgc |
40801995 |
T |
|
| Q |
205 |
aacaatggtggaga-agttagatctaagttgaaaaaattac |
244 |
Q |
| |
|
||||| |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
40801996 |
aacaa-ggtggagagagttagatctaagttgagaaaattac |
40802035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University