View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5251-Insertion-6 (Length: 189)
Name: NF5251-Insertion-6
Description: NF5251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5251-Insertion-6 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 31230383 - 31230563
Alignment:
| Q |
8 |
atatgtgtgataaactgttgtaaaagcattacacattggtcagataaacggatatgttatgcttactaaagaaaaaggtcattcagataaatctattgtt |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31230383 |
atatgtgtgatacactgttgtaaaagcattacacattggtcagataaact-atatgttatgcttactaaagaaaaaggtcattcagataaatctattgtt |
31230481 |
T |
 |
| Q |
108 |
gcaaatggaggttaaagtagaagtgacatggatgaattgaattagaatatatatcagataacatattttctattatggtttc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31230482 |
gcaaatggaggttaaagtagaagtgacatggatgaattgaattagaatatatatcagataacatattttctattatggtttc |
31230563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University