View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5251_high_16 (Length: 235)
Name: NF5251_high_16
Description: NF5251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5251_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 38959606 - 38959811
Alignment:
| Q |
18 |
caagcatcaccggacataaccgggaaggtggaagagagcataaagagtgcggaagaggcgtgtgcaggagacgccactagcggtgaatgtgtggcagcgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38959606 |
caagcatcaccggacataaccgggaaggtggaagagagcataaagagtgcggaagaggcgtgtgcaggagacgccactagcggtgaatgtgtggcggcgt |
38959705 |
T |
 |
| Q |
118 |
gggatgaggtggaggaattgagtgcagcggcaagccatgcaagggataagaaaaagacgtcggaccctctcgaggaatactgcaaggacaatccggagac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38959706 |
gggatgaggtggaggaattgagtgcagcggcaagccatgcaagggataagaaaaagacgtcggaccctctcgaggaatactgcaaggacaatccggagac |
38959805 |
T |
 |
| Q |
218 |
tgatga |
223 |
Q |
| |
|
|||||| |
|
|
| T |
38959806 |
tgatga |
38959811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University