View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5251_low_11 (Length: 292)
Name: NF5251_low_11
Description: NF5251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5251_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 2094909 - 2094654
Alignment:
| Q |
16 |
attcaggaatagtgcacattttttaagcttttgaagaagttgcacttgttgagtcnnnnnnn-ttaattgctcttattttttctatggacagacataagt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2094909 |
attcaggaatagtgcacattttttaagcttttgaagaagttgcacttgttgagtcaaaaaaaattaattgctcttgttttttttatggacagacataagc |
2094810 |
T |
 |
| Q |
115 |
ccctctcttattcttttcgtcatcttgtttgatctactttgattttgatttcaattatctgtttgtccgtagtatgcgatcaaaggtgtttgaacggtca |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2094809 |
ccctttcttattcttttcgtcatcttgtttgatctactttgattt------caattatctgtttgtccgtagtatgcgatcaaaggtgtttgaacggtca |
2094716 |
T |
 |
| Q |
215 |
ggacctatgttggaccatccaactattagagatgatctatatccattttttgacccataatt |
276 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2094715 |
ggacctatgttggaccatccagctattagagaggatctatatccattttttgacccataatt |
2094654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University