View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5251_low_15 (Length: 252)
Name: NF5251_low_15
Description: NF5251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5251_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 64 - 240
Target Start/End: Original strand, 47560740 - 47560923
Alignment:
| Q |
64 |
aaattcaaaaagctcaaagagaactcagatttactataagaaggatattgttggagtgttgatgtaaacaaataatctactagttgtcggaagaagatgt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47560740 |
aaattcaaaaagctcaaagagaactcagatttgctagaagaaggatattgttggagtgctgatataaacaaataatctactagttgtcggaagaagatgt |
47560839 |
T |
 |
| Q |
164 |
gtttcagtgttgattttg-------nnnnnnnnncgattttgttgatggagattgatggacgaccaattgctgtaacataggtg |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
47560840 |
gtttcagtgttgattttgaaaagaaaaaaaaaaacgattttgttgatggagattgatggacgtcgaattgttgtaacataggtg |
47560923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University