View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252-Insertion-4 (Length: 343)
Name: NF5252-Insertion-4
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252-Insertion-4 |
 |  |
|
| [»] scaffold0125 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 12818646 - 12818574
Alignment:
| Q |
7 |
acttcattagtttcatatacaaatttttaggaattcccttttgattcttgtttttgggtattctttgaagata |
79 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12818646 |
acttcattagtttcatatacaattttttaggaattcccttttgattcttttttttgggtattctttgaagata |
12818574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0125 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: scaffold0125
Description:
Target: scaffold0125; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 7 - 84
Target Start/End: Complemental strand, 20263 - 20186
Alignment:
| Q |
7 |
acttcattagtttcatatacaaatttttaggaattcccttttgattcttgtttttgggtattctttgaagatatctat |
84 |
Q |
| |
|
||||||||||||||||| | ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20263 |
acttcattagtttcataaaaaaaaatttagaaattcccttttgattcttgtttttgggtattctttgaagatatctat |
20186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0125; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 20033 - 19977
Alignment:
| Q |
285 |
gttgatttttat-gttgtgctgttctgctatctgcatttagccggttctgtttgtct |
340 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
20033 |
gttgatttttattgttgtgctgttctgctatctgcatttagctggttctttttgtct |
19977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 10660049 - 10660126
Alignment:
| Q |
7 |
acttcattagtttcatatacaaatttttaggaattcccttttgattcttgtttttgggtattctttgaagatatctat |
84 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10660049 |
acttcattagtttcatataattttttttaggaattcccttttgatttttgtttttgggtattctttgaagatatctat |
10660126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 10874194 - 10874271
Alignment:
| Q |
7 |
acttcattagtttcatatacaaatttttaggaattcccttttgattcttgtttttgggtattctttgaagatatctat |
84 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10874194 |
acttcattagtttcatataattttttttaggaattcccttttgatttttgtttttgggtattctttgaagatatctat |
10874271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 340
Target Start/End: Original strand, 10660613 - 10660657
Alignment:
| Q |
296 |
tgttgtgctgttctgctatctgcatttagccggttctgtttgtct |
340 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
10660613 |
tgttgtgctattatgctatctgcatttagccggttctttttgtct |
10660657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 340
Target Start/End: Original strand, 10874758 - 10874802
Alignment:
| Q |
296 |
tgttgtgctgttctgctatctgcatttagccggttctgtttgtct |
340 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
10874758 |
tgttgtgctattatgctatctgcatttagccggttctttttgtct |
10874802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 21843612 - 21843666
Alignment:
| Q |
30 |
tttttaggaattcccttttgattcttgtttttgggtattctttgaagatatctat |
84 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21843612 |
tttttagaaattcccttttgattcttgtttttgggtattctttgaagatatctat |
21843666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 21843819 - 21843875
Alignment:
| Q |
285 |
gttgatttttat-gttgtgctgttctgctatctgcatttagccggttctgtttgtct |
340 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21843819 |
gttgatttttattgttatgctgttctgctatctgcatttagccggttctttttgtct |
21843875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University