View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252-Insertion-5 (Length: 240)
Name: NF5252-Insertion-5
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 6 - 240
Target Start/End: Original strand, 39210236 - 39210470
Alignment:
| Q |
6 |
caaacctaacggacccaaaagggttgaaatgacgaagcagcgaagtggcgttggtatctgtatcatccaaatatggtcctgaagcaacaaacagagtagt |
105 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210236 |
caaacctaacagacccaaaagggttgaaatgacgaagcagccaagtggcgttggcgtatgtatcatccaaatatggtcctgaagcaacaaacagagtagt |
39210335 |
T |
|
| Q |
106 |
tgtgaaagaagcttcgaaaaacattgattacaacgacgaaccatcgatcactaaagtgagtttgatgtaacgtcatgaagagcaggccacgatgagcgtg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210336 |
tgtgaaagaagcttcgaaaaacattgattacaacgacgaaccatcgatcactaaagtgagtttgatgtaacgtcatgaagagcaggccacgatgagcgtg |
39210435 |
T |
|
| Q |
206 |
gtgaggctcgacactgatgatcgatagggatgtta |
240 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| |
|
|
| T |
39210436 |
gtgaggctcgacaccgatgattgatagggatgtta |
39210470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University