View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252-Insertion-7 (Length: 102)
Name: NF5252-Insertion-7
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252-Insertion-7 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 5e-47; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 8 - 102
Target Start/End: Complemental strand, 26991532 - 26991438
Alignment:
| Q |
8 |
gaacaagcacaagaagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26991532 |
gaacaagcacaagaagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg |
26991438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 4e-32
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 27005965 - 27005884
Alignment:
| Q |
21 |
aagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
27005965 |
aagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgtattgtttactggacctgctattgg |
27005884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 26975935 - 26976022
Alignment:
| Q |
18 |
aagaagaagaagtgaaggaact---ggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
26975935 |
aagaagaagaagtgaaggaactactggttgagcaaagtatatggattcagatgaaggaaattgtattgtttactggacctgctattgg |
26976022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University