View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5252-Insertion-7 (Length: 102)

Name: NF5252-Insertion-7
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5252-Insertion-7
NF5252-Insertion-7
[»] chr4 (3 HSPs)
chr4 (8-102)||(26991438-26991532)
chr4 (21-102)||(27005884-27005965)
chr4 (18-102)||(26975935-26976022)


Alignment Details
Target: chr4 (Bit Score: 95; Significance: 5e-47; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 8 - 102
Target Start/End: Complemental strand, 26991532 - 26991438
Alignment:
8 gaacaagcacaagaagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26991532 gaacaagcacaagaagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg 26991438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 4e-32
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 27005965 - 27005884
Alignment:
21 aagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||    
27005965 aagaagaagtgaaggaactggttgagcagagtatatggattcagatgaaggaaattgtattgtttactggacctgctattgg 27005884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 26975935 - 26976022
Alignment:
18 aagaagaagaagtgaaggaact---ggttgagcagagtatatggattcagatgaaggaaattgttttatttactggacctgcaattgg 102  Q
    ||||||||||||||||||||||   ||||||||| ||||||||||||||||||||||||||||| || |||||||||||||| |||||    
26975935 aagaagaagaagtgaaggaactactggttgagcaaagtatatggattcagatgaaggaaattgtattgtttactggacctgctattgg 26976022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University