View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252-Insertion-8 (Length: 135)
Name: NF5252-Insertion-8
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252-Insertion-8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 1e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 8 - 107
Target Start/End: Original strand, 10027866 - 10027965
Alignment:
| Q |
8 |
aattgtcctatactttattatatatgttgagtataatattgtatgtactaattcatgataaaataatttcagcgtagaaatgagatatagctgtgttatg |
107 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10027866 |
aattgtcttatactttattatatattttgagtataatattgtatgtactaattcatgatcaaataatttcagcgtagaaatgagatatagctgtgttatg |
10027965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 8 - 107
Target Start/End: Original strand, 10047719 - 10047818
Alignment:
| Q |
8 |
aattgtcctatactttattatatatgttgagtataatattgtatgtactaattcatgataaaataatttcagcgtagaaatgagatatagctgtgttatg |
107 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10047719 |
aattgtcttatactttattatatattttgagtataatattgtatgtactaattcatgatcaaataatttcagcgtagaaatgagatatagctgtgttatg |
10047818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University