View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252_high_2 (Length: 470)
Name: NF5252_high_2
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 334
Target Start/End: Complemental strand, 39210242 - 39209926
Alignment:
| Q |
18 |
aggtttggtttgggttcaggtctgggtatttttccctggtttgaatgattttccaagcatatattattgtttgttttattattagtggctccaatgtgca |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210242 |
aggtttggtttgggttcaggtctgggtgtttttccctggtttgaatgattttccaagcagatattattgtttgttttattattagtggctccaatgtgca |
39210143 |
T |
 |
| Q |
118 |
tgttggttatgcaccactgttttattcgagtcactctttatgattggcgctacaaattgctggctagaaatgaccgtaaaggtttttgatttgatgcact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210142 |
tgttggttatgcaccactgttttattcgagtcactctttatgattggcgctacaaattgctggctagaaatgaccgtaaaggtttttgatttgatgcact |
39210043 |
T |
 |
| Q |
218 |
gagttgtaggatgtggatcagtattcgtgttggtggtctggtccattactcacccttaaagatctagattatatgttgtaaacattcacccatttctttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210042 |
gagttgtaggatgtggatcagtattcgtgttggtggtctggtccattattcatccttaaagatctagattatatgttgtaaacattcacccatttctttt |
39209943 |
T |
 |
| Q |
318 |
ttgcaatttggcttcaa |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39209942 |
ttgcaatttggcttcaa |
39209926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University