View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252_high_5 (Length: 315)
Name: NF5252_high_5
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 37155007 - 37154699
Alignment:
| Q |
1 |
caataccctcaatcgcagccacaacaacaccagcaaccagaacatcccagtcaccggtttgaccaaggattgtggctagtgcatttgccgtgtagaaacc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37155007 |
caataccctcaattgcagccacaacaacaccagcaaccagaacatcccagtcaccggtttgaccaaggattgtggctagtgcatttgccgtgtagaaacc |
37154908 |
T |
 |
| Q |
101 |
caaaagcagcaggaatactttcgtagggaagttctttctagctgaattcagcttatccagaagttgtctgccacctgcacttagtatcctacccaatcga |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37154907 |
caaaagtagcaggaatactttcgtagggaagttctttctagctgaattcagcttatctagaagttgtctgccacctgcacttagtatcctacccaatcga |
37154808 |
T |
 |
| Q |
201 |
gtgccacctaaactggaaccagaatcatttaggctttgttgctcaccattaccagacaatccatctgtgttcaacgccaaagctactgtccacccaggtc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37154807 |
gtgccacctaaactggaaccagaatcatttaggctttgttgctcaccattaccagacaatccatctgtgttcaacgcaaaagctactgtccacccaggtc |
37154708 |
T |
 |
| Q |
301 |
ttcatctca |
309 |
Q |
| |
|
||| ||||| |
|
|
| T |
37154707 |
ttcttctca |
37154699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University