View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252_high_6 (Length: 313)
Name: NF5252_high_6
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 56578476 - 56578759
Alignment:
| Q |
19 |
cctacaagtgctaatcaagctgcagattgcttgggaaaaagagggctttcttttggattgattagtgatgtctatgataatgttcccannnnnnnnnng- |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
56578476 |
cctacaagtgctaatcaagctgcagattgcttgggaaaaagagggctttcttttggattgattagtgatgtctatgataatgttcccatttttttttggg |
56578575 |
T |
 |
| Q |
118 |
ttaagatttcttttggaagatgtaatgcattttggtaagtttatgagatccttgtatatcacaaatgtccaagtaacatttccaattttaaacatggtaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56578576 |
ttaagatttcttttggaagatgtaatgcattttggtaagtttatgagatccttgtatatcacaaatgtccaagtaacatttccaattttaaacatggtaa |
56578675 |
T |
 |
| Q |
218 |
gtttatgagatccccttgtatcacaaatgtcgaaataacatttccaattttaaacatcaggcnnnnnnntgccacaaatgcctatg |
303 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56578676 |
gtttatgagat--ccttgtatcacaaatgtcgaaataacatttccaattttaaacatcaggcaaaaaaatgccacaaatgcctatg |
56578759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University