View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5252_high_7 (Length: 276)
Name: NF5252_high_7
Description: NF5252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5252_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 31787070 - 31786935
Alignment:
| Q |
1 |
gcactggaacaggtcatggaacaactggctatggtgatgagcaacaccatggtgagaagaaagggatcatggagaagattaaggagaagcttcctggtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31787070 |
gcactggaacaggtcatggaacaactggctatggtgatgagcaacaccatggtgagaagaaagggatcatggagaagattaaggagaagcttcctggtac |
31786971 |
T |
|
| Q |
101 |
cggatcatgtactggacatggacaaggacactagac |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786970 |
cggatcatgtactggacatggacaaggacactagac |
31786935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 185 - 258
Target Start/End: Complemental strand, 31786886 - 31786813
Alignment:
| Q |
185 |
caatcagtagaataaatatgtgtgtgtattggtgtattttaaacttttgtttttgagtgagttggttcgtatgt |
258 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786886 |
caatcagtagaataaatgtgtgtgtgtattgatgtattttaaacttttgtttttgagtgagttggttcgtatgt |
31786813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 31787106 - 31787073
Alignment:
| Q |
1 |
gcactggaacaggtcatggaacaactggctatgg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31787106 |
gcactggaacaggtcatggaacaactggctatgg |
31787073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University