View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5253_high_11 (Length: 239)
Name: NF5253_high_11
Description: NF5253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5253_high_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 2654702 - 2654923
Alignment:
| Q |
18 |
gatatttctccacaagagggcgatcttcatgaaattgaacactaggattgcctaaaagaataagagggcaggccatgtcccagccaccacagtcgcaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2654702 |
gatatttctccacaagagggcgatcttcatgaaattgaacactaggattgcctaaaagaataagagggcaggccatgtcccagccaccacagtcgcaacc |
2654801 |
T |
|
| Q |
118 |
tccaccatgtttccatcgatcaagtaacaatgaaggaccctcactttcagcactcggcaaaccatggtttccaattggtagtaccaccttcacttgctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2654802 |
tccaccatgtttccatcgatcaagtaacgatgaaggaccctcactttcagcactcggcaaaccatggtttccaattggtagtaccaccttcacttgctct |
2654901 |
T |
|
| Q |
218 |
actggtgaagagacgtcacttt |
239 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
2654902 |
actggtgaagagacatcacttt |
2654923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 49 - 209
Target Start/End: Complemental strand, 40965736 - 40965576
Alignment:
| Q |
49 |
aaattgaacactaggattgcctaaaagaataagagggcaggccatgtcccagccaccacagtcgcaacctccaccatgtttccatcgatcaagtaacaat |
148 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||| || |||||||||||||| ||||||||||| |||||||| || ||| || |||||||||||||| || |
|
|
| T |
40965736 |
aaattgaatactaggattgcctaaaagtacaaggggacaggccatgtcccaaccaccacagtcacaacctccgccgtgtctcaatcgatcaagtaacgat |
40965637 |
T |
|
| Q |
149 |
gaaggaccctcactttcagcactcggcaaaccatggtttccaattggtagtaccaccttca |
209 |
Q |
| |
|
|| ||||||| | |||||| | ||||||||||||| ||| | |||| ||||||||||| |
|
|
| T |
40965636 |
gagggacccttgcattcagcgtttggcaaaccatggtagccagtcggtattaccaccttca |
40965576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University