View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5253_high_4 (Length: 340)
Name: NF5253_high_4
Description: NF5253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5253_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 49171409 - 49171496
Alignment:
| Q |
1 |
gctttctctttctgtgcaaaacttcaattttaactcacttgtattactatgcatgaatgactaaaaataagtccaaagtagaatgatg |
88 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49171409 |
gctttctttttctgtgcaaaacttcaattttaactcacttgtattactatccatgaatgactaaaaataagtccaaagtagaatgatg |
49171496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 128 - 207
Target Start/End: Original strand, 49171536 - 49171615
Alignment:
| Q |
128 |
ggaagctaatggttcaattttgaccttttgagtttgttttaacatgaacttgaccttttgagcttattttaagtggcatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
49171536 |
ggaagctaatggttcaattttgaccttttgagtttgttttaacatgaaattgacctattgagcttattttaagtggcatg |
49171615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University