View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5253_high_7 (Length: 334)
Name: NF5253_high_7
Description: NF5253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5253_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 19 - 324
Target Start/End: Complemental strand, 42272612 - 42272307
Alignment:
| Q |
19 |
agagtagggtggtgtacctgcaaggactccaacacttaagtcagtgaaggttttaggaatcaagaggttattcaaagactaacttttgtacctttttata |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272612 |
agagtaaggtggtgtacctgcaaggactccaacacttaagtcagtgaaggttttaggaattaagaggttattcaaagactaacttttgtacctttttata |
42272513 |
T |
 |
| Q |
119 |
ggagaatgacttctaaattaggtggttggagtcaccacatggacgtgaggccgttaggcggttgtgctttacataacgcctcattcggaccaccgctcaa |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272512 |
ggagaatgacttctagattaggtggttggagtcgccacatggacgtgaggccgttaggcggttgtgctttacataacgcctcattcggaccaccgctcaa |
42272413 |
T |
 |
| Q |
219 |
ttgatatggaagggttaaaaatagttttgggctcttttttcctacttagaggctctatggtgacccatatttgaatcaaacacgtcgtcaggcctttatc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42272412 |
ttgatatggaagggttaaaaatagttttgggctcttttttcctacttagaggctctatggtgacccatatttgaatcaaacacgtcgtcatgcctttatc |
42272313 |
T |
 |
| Q |
319 |
cctttg |
324 |
Q |
| |
|
|||||| |
|
|
| T |
42272312 |
cctttg |
42272307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University