View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5253_low_8 (Length: 297)

Name: NF5253_low_8
Description: NF5253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5253_low_8
NF5253_low_8
[»] chr3 (2 HSPs)
chr3 (63-265)||(19396531-19396734)
chr3 (18-50)||(19396736-19396768)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 63 - 265
Target Start/End: Complemental strand, 19396734 - 19396531
Alignment:
63 tatctacattcattgataatagcatgaaaatcagaaatgccttgcttattgtcgtagatgctgtcaacgatagttttggaatccgtctcagaatccatgt 162  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||    
19396734 tatctacattcattgataataacatgaaaatcagaaatgccttgcttattgtcgtagatactgtcaacgatagttttggaatccgtctcaaaatccatgt 19396635  T
163 taaccagttggagatcatgaacccattgaagaaccgagagcatacataatactt-cccccaagtctacatctaccaaaggtgaaatccattccgacctgg 261  Q
    |||| || |||||||||||||||||||||||| ||||||||| || ||| |||| |||||||||||||||||||||||||||||||||||||||| ||||    
19396634 taactagctggagatcatgaacccattgaagagccgagagcacacctaacacttccccccaagtctacatctaccaaaggtgaaatccattccgatctgg 19396535  T
262 ctaa 265  Q
    ||||    
19396534 ctaa 19396531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 19396768 - 19396736
Alignment:
18 ctaataaacctcacattataggttactaagtca 50  Q
    |||||||||||||||||| ||||||||||||||    
19396768 ctaataaacctcacattagaggttactaagtca 19396736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University