View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5253_low_8 (Length: 297)
Name: NF5253_low_8
Description: NF5253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5253_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 63 - 265
Target Start/End: Complemental strand, 19396734 - 19396531
Alignment:
| Q |
63 |
tatctacattcattgataatagcatgaaaatcagaaatgccttgcttattgtcgtagatgctgtcaacgatagttttggaatccgtctcagaatccatgt |
162 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19396734 |
tatctacattcattgataataacatgaaaatcagaaatgccttgcttattgtcgtagatactgtcaacgatagttttggaatccgtctcaaaatccatgt |
19396635 |
T |
 |
| Q |
163 |
taaccagttggagatcatgaacccattgaagaaccgagagcatacataatactt-cccccaagtctacatctaccaaaggtgaaatccattccgacctgg |
261 |
Q |
| |
|
|||| || |||||||||||||||||||||||| ||||||||| || ||| |||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19396634 |
taactagctggagatcatgaacccattgaagagccgagagcacacctaacacttccccccaagtctacatctaccaaaggtgaaatccattccgatctgg |
19396535 |
T |
 |
| Q |
262 |
ctaa |
265 |
Q |
| |
|
|||| |
|
|
| T |
19396534 |
ctaa |
19396531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 19396768 - 19396736
Alignment:
| Q |
18 |
ctaataaacctcacattataggttactaagtca |
50 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
19396768 |
ctaataaacctcacattagaggttactaagtca |
19396736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University