View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5254-Insertion-3 (Length: 305)
Name: NF5254-Insertion-3
Description: NF5254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5254-Insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 23 - 274
Target Start/End: Complemental strand, 44989330 - 44989079
Alignment:
| Q |
23 |
aacaattgttttattaacatccatctattttattttatttcttttgcagccaccatatgctccttgttacctctttctagcattattagtgtcaatattt |
122 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44989330 |
aacaattgttttattaacatgcatctattttattttatttcttttgcagccaccatatgctccttgttacctctttctagcattattgatgtcaatattt |
44989231 |
T |
|
| Q |
123 |
ttaggaaaagtgataaccataaactagttcacattgtgacatgaatcttcaacttgggagttgatgcttttacatcttcacctaaaagagcaataacatc |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44989230 |
ttaggaaaactgataaccataaactagttcacattgtaacatgaatcttcaacttgggagctgatgcttttacatcttcacctaaaagagcaataacatc |
44989131 |
T |
|
| Q |
223 |
ttgagttttctaagaatattggttaatgaataatttcagtctcagagtattg |
274 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44989130 |
ttgagttttctaaggatattggttaatgaataatttcagtctcagagtattg |
44989079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 262
Target Start/End: Complemental strand, 36854743 - 36854670
Alignment:
| Q |
189 |
cttttacatcttcacctaaaagagcaataacatcttgagttttctaagaatattggttaatgaataatttcagt |
262 |
Q |
| |
|
||||| |||||||||| ||||||| ||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
36854743 |
cttttgcatcttcacccgaaagagccgcaacatcttgagctttctaagaatatttgtttgtgaataatttcagt |
36854670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University