View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5254_high_4 (Length: 330)
Name: NF5254_high_4
Description: NF5254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5254_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 317
Target Start/End: Original strand, 9839418 - 9839718
Alignment:
| Q |
17 |
ataaacaaatatggtcgatgtggctgcaattacagtcgcgctgaggttccaaaggcatcgaaaacctcgtatacaacaggcacaatctcggttgtacact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9839418 |
ataaacaaatatggtcgatgtggctgcaattacagtcgcgctgaggttccaaaggcatcgaaaacctcgtatacaacaggcacaatctcggttgtacact |
9839517 |
T |
|
| Q |
117 |
gcaatttaaaaccttagtttaaactaaagatagaaaccttttgctactcattaacaaactaaaggataaagataacttttgccacaagaatagtaggtgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9839518 |
gcaatttaaaaccttagtttaaactaaagatagaaaccttttgctactcattaacaaacttaaggataaagataacttttgccacaagaatagtaggtgg |
9839617 |
T |
|
| Q |
217 |
catgtgaaggaaccataatcactgaattaataaaacaaacatgaaggtatatacatgagtttagttgatcatatacctgctaactctaactgcttctatc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9839618 |
catgtgaaggaaccataatcactgaattaataagacaaacatgaaggtatatacatgagtttaattgatcatatacctgctaactctaactgcttctatc |
9839717 |
T |
|
| Q |
317 |
t |
317 |
Q |
| |
|
| |
|
|
| T |
9839718 |
t |
9839718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University