View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5254_high_8 (Length: 215)
Name: NF5254_high_8
Description: NF5254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5254_high_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 37108694 - 37108498
Alignment:
| Q |
19 |
aaactgattggagcaaggtatttcaacaaaggctatgcttcgagactaactgtcccactaaattcttcctttgaaacacctcgtgacaatgaaggtcatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108694 |
aaactgattggagcaaggtatttcaacaaaggctatgcttcgagactaactgtcccactaaattcttcctttgaaacacctcgtgacaatgaaggtcatg |
37108595 |
T |
 |
| Q |
119 |
gatctcatactttatcaacagccggtggaaacatggtacctggagtcagtgtcttcggtcaagggtatggaacagcaaagggtggttcaccaaaagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37108594 |
gatctcatactttatcaacagccggtggaaacatggtacctggagtcagtgtcttcggtcaaggctatggaacagcaaagggtggttcaccaaaagc |
37108498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University