View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5254_low_6 (Length: 253)
Name: NF5254_low_6
Description: NF5254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5254_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 38001126 - 38000889
Alignment:
| Q |
1 |
aatatggattgacatcttatcatggcaagaactagttggtgcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38001126 |
aatatggattgacatcttatcatggcaagaactagttggttcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaaatga |
38001027 |
T |
|
| Q |
101 |
attacctcagttggaataccaaatataatttttgagatgaatcgtaaacatgtagttggtgatggcgcagctaaaacagttacaccataaaatggctcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38001026 |
attacctcagttggaataccaaatataatttttgagatgaatcgtaaacatgtagttggtgatggcgcagctaaaacagttagaccataaaatggctcac |
38000927 |
T |
|
| Q |
201 |
tcataattaattttgtaccatacttggaaggttaagat |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38000926 |
tcataattatttttgtaccatacttggaaggttaagat |
38000889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University