View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255-Insertion-4 (Length: 427)
Name: NF5255-Insertion-4
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255-Insertion-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 8 - 319
Target Start/End: Original strand, 20479314 - 20479625
Alignment:
| Q |
8 |
ttatcgttgacacatttacttttcgctagattggcaatgtagcttccgtgtggtcggtgtcagagagttgacattctttcttttcgattcctttagattg |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479314 |
ttatcattgacacatttacttttcgctagattggcaatgttgcttccgtgttgtcggtgtcagagagttgacattctttcttttcgattcctttagattg |
20479413 |
T |
|
| Q |
108 |
gtgttcaacagaggtattggtgtagccatagcagcagttgtgtttttctgctttacggggcattcctgtttcatgattcattgttatttttgttacttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20479414 |
gtgttcaacagaggtattggtgtagccgtagcagcagttgtgtttttctgctttacggggcattcctgtttcatggttcattgttatttttgttacttct |
20479513 |
T |
|
| Q |
208 |
tggttctgtctggacggattcgattagtctggggagttgttgtacttgattttttgaggccgttttttcggtgtcagttgaagcgcttttagagtgatca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479514 |
tggttctgtctggacggattcgattagtctggggagttgttgtacttgattttttgaggccgttttttcggtgtcagttgaagcgcttttagagtgatca |
20479613 |
T |
|
| Q |
308 |
aagttctgctgc |
319 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20479614 |
aagttctgctgc |
20479625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University