View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_high_28 (Length: 301)
Name: NF5255_high_28
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 210
Target Start/End: Original strand, 39724827 - 39725035
Alignment:
| Q |
7 |
tgtggaacacggcgagggtgtcatcaaccttttgaaatattgatatcttctttccaagtaccatcattgtgtaccatggcacacttcctgatagcactcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39724827 |
tgtggaacacggcgagggtgtcatcaaccttttgaaatattgatatcttctttccaagtaccatcattgtgtaccatggcacacttcctgatagcactcc |
39724926 |
T |
 |
| Q |
107 |
cattactatggcagcccatccttgaaccaaacctattcacaaacaataaatttttacataa----tacttaacagcaatttgaagccatta-tatttaac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
39724927 |
cattactatggcagcccatccttgaaccaaacctattcacaaacaataaatttttacataatacgtacttaacagcaatttgaagccattattatttaac |
39725026 |
T |
 |
| Q |
202 |
tttgtattt |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
39725027 |
tttgtattt |
39725035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University