View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_high_47 (Length: 251)
Name: NF5255_high_47
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_high_47 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 34880357 - 34880120
Alignment:
| Q |
1 |
aaatttgattgtatatgatgtgatcatgtgacagtgttatcaattctgaggtcaatgtaacnnnnnnnnnnn-gtaggctgtggatatttctccaaatcc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34880357 |
aaatttgattgtatatgatgtgatcatgtgacagtgttatcaattctgaggtcaatgtaacttttttttttttgtaggctgtggatatttctccaaatcc |
34880258 |
T |
|
| Q |
100 |
tggacgctcggatcctatgtacattgtgtactctaggaagctggctaccgcataagagaaacatgaaccgataattcgtagctgtgcctttacctatcag |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880257 |
tggacgctcggatcccatgtacattgtgtactctaggaagctggctaccgcataagagaaacatgaaccgataattcgtagctgtgcctttacctatcag |
34880158 |
T |
|
| Q |
200 |
cagttactgtgatggggaattcgctcatattgtatgcc |
237 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34880157 |
cagttattgtgatggggaattcgctcatattgtatgcc |
34880120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University