View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_high_53 (Length: 235)
Name: NF5255_high_53
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_high_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 218
Target Start/End: Complemental strand, 899043 - 898836
Alignment:
| Q |
11 |
gataattctagaagtggaacaataagttcttgattataaaactcttggtatttgacaaaagctaaaagtgattttatgataatgtcttgtcataatactt |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
899043 |
gataattatagaagtggaacaataagttcttgattataaaactcttggtatttgacaaaagctaaaagtgattttatgataatgtcttgtcacaatactt |
898944 |
T |
|
| Q |
111 |
tcattccacaaaagaaagtgcaataattttgataaggttacctaaatagctaccatcgacattaaaaatggtgcaacaacgattagatgagttccattaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898943 |
tcattccacaaaagaaagtgcaataattttgataaggttacctaaatagctaccatcgacattaaaaatggtgcaacaacgattagatgagttccattaa |
898844 |
T |
|
| Q |
211 |
acccatac |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
898843 |
acccatac |
898836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University