View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_low_50 (Length: 242)
Name: NF5255_low_50
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 45181841 - 45181700
Alignment:
| Q |
1 |
ctctaatagtaatacacaaccatgttgatctgtttcattaaacaattatgttttgccttttaagattttcagatggaacctacaaattataatcagtaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45181841 |
ctctaatagtaatacacaaccatgttgatctgtttcattaaacaattatgttttgccttttaagattttcagatggaacgtacaaattataatcagtaat |
45181742 |
T |
|
| Q |
101 |
tacctctatcaacgtatgcttacttaatttacctacttttac |
142 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45181741 |
tacctctatcaacgtatgcttacttgatttacctacttttac |
45181700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 33 - 220
Target Start/End: Complemental strand, 45174927 - 45174745
Alignment:
| Q |
33 |
tttcattaaacaattatgttttgcctttt-aagattttcagatggaacctacaaattataatcagtaattacctctatcaac-gtatgcttacttaattt |
130 |
Q |
| |
|
|||||| || |||||||||||| |||||| ||||||||||| ||||||||||||||| |||| || ||||||| | ||| | |||| ||||||||| |
|
|
| T |
45174927 |
tttcatcaatcaattatgtttttcctttttaagattttcagttggaacctacaaattgcaatc--tagctacctctctaaaccgcttgctgacttaattt |
45174830 |
T |
|
| Q |
131 |
acctacttttacaaaggactatattatattgcaactaggtggtaccgtgcacctgaactatgtggttcttttttcacaaaagtaagtttt |
220 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45174829 |
acctacttttaccaaggactatgtt-----gcaactaggtggtaccgtgcacctgaactatgtggttcttttttctcaaaagtaagtttt |
45174745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 173 - 236
Target Start/End: Complemental strand, 45181702 - 45181639
Alignment:
| Q |
173 |
taccgtgcacctgaactatgtggttcttttttcacaaaagtaagttttttgtttgacatcatat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45181702 |
taccgtgcacctgaactatgtggttcttttttcacaaaagtaagttttttgtttgacatcatat |
45181639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 216
Target Start/End: Complemental strand, 29962023 - 29961966
Alignment:
| Q |
159 |
ttgcaactaggtggtaccgtgcacctgaactatgtggttcttttttcacaaaagtaag |
216 |
Q |
| |
|
|||| ||| ||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29962023 |
ttgcgactcggtggtatcgtgcacctgaactatgtggttcttttttctcaaaagtaag |
29961966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University