View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_low_51 (Length: 239)
Name: NF5255_low_51
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_low_51 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 7 - 239
Target Start/End: Original strand, 37581001 - 37581234
Alignment:
| Q |
7 |
ggacatcatcaaggggaagacgccggaggagattcgcaagacatttaacagtcagaataacttcagtccaaagccgaatgaagaggaggcagctcgtccc |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37581001 |
ggacatgatcaaggggaagacgccggaggagattcgcaagacgtttaacagtcagaataacttcagtccaaagccgaacgaagaggaggcagctcgtccc |
37581100 |
T |
|
| Q |
107 |
ggggaaaacccat-ggaatcaataattgtggttannnnnnnnnnnnnnnngtccatgtattgcctatgttcctaaagggcaaacaaactaactagaagag |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
37581101 |
ggggaaaacccatgggaatcaataattgtggttatttttgttttgtttttgtccatgcattgcccatgttcctgaagggcaaacaaactaactagaagag |
37581200 |
T |
|
| Q |
206 |
agggccctagaagaaattcttattttgatcatat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
37581201 |
agggccctagaagaaattcttattttgaccatat |
37581234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 8992563 - 8992611
Alignment:
| Q |
8 |
gacatcatcaaggggaagacgccggaggagattcgcaagacatttaaca |
56 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
8992563 |
gacatgatcaaggggaagacacctgaggagattcgcaagacctttaaca |
8992611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University