View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_low_55 (Length: 236)
Name: NF5255_low_55
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_low_55 |
 |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0276 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 20119 - 19900
Alignment:
| Q |
1 |
cggtgcttttcaaggtcaacaactacccatccatttcattgacttttatttcaccatcaatctctttcgtttttctcgatctatctagtttgatcannnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20119 |
cggtgcttttcaaggtcaacaactacccatccatttcattgacttttatttcaccatcattctctttcgtttttctcgatctatctagtttgatcatttt |
20020 |
T |
 |
| Q |
101 |
nnnnnnattattattacttttggattggtgataactctgatctcttaattagatcatagattaatcagatgcataatgcattacactatgtgtttggtgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20019 |
ttttt--ttattattacttttggattggtgataactctgatctcttaattagatcatagattaatcagatgcataatgcattacactatgtgtttggtgt |
19922 |
T |
 |
| Q |
201 |
atcaatactgttagatatatat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19921 |
atcaatactgttagatatatat |
19900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University