View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_low_57 (Length: 232)
Name: NF5255_low_57
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 41562126 - 41562326
Alignment:
| Q |
15 |
caaaggcatggaaaggagctattgatcaattcaaagaatctgaactctcagcacaagggatattggtgaatacttttgaggagctggagaaggtttatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41562126 |
caaaggcatggaaaggagctattgatcaattcaaagaatctgaactctcagcacaagggatattggtgaatacttttgaggagctggagaaggtttatgt |
41562225 |
T |
 |
| Q |
115 |
tagaggttatgagaaagttgctaaaaaggtttggtgtataggaccactttccttgcatgacaagttaaccttcaacaagtttggtaaagacgataaggga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41562226 |
tagaggttatgagaaagttgctaaaaaggtttggtgtataggaccactttccttgcatgacaggttaaccttcaacaagtttggtaaagacgataaggga |
41562325 |
T |
 |
| Q |
215 |
t |
215 |
Q |
| |
|
| |
|
|
| T |
41562326 |
t |
41562326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 46656776 - 46656852
Alignment:
| Q |
15 |
caaaggcatggaaaggagctattgatcaattcaaagaatctgaactctcagcacaagggatattggtgaatactttt |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
46656776 |
caaaggcatggaaagaagctattgatcaattcaaagaatctaaactctcagcacaaggaatattggtgaatactttt |
46656852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 149
Target Start/End: Original strand, 46656862 - 46656890
Alignment:
| Q |
121 |
ttatgagaaagttgctaaaaaggtttggt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46656862 |
ttatgagaaagttgctaaaaaggtttggt |
46656890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University