View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5255_low_59 (Length: 205)
Name: NF5255_low_59
Description: NF5255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5255_low_59 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 32 - 205
Target Start/End: Complemental strand, 5768705 - 5768532
Alignment:
| Q |
32 |
tttgctctgcaccttactgtgcccagtgagataaaccaaggacatccactacactactcaagcatgcaacctaacttgtaatcctgaacatgaaataaga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5768705 |
tttgctctgcaccttactgtgcccagtgagataaaccaaggacatccactacactactcaagcatgcaacctaacttgtaatcctgaacatgaaataaga |
5768606 |
T |
 |
| Q |
132 |
tccaaatgctgattcacgttgtagaagaatacgaacaccaaaccataacttgcaagttgaatcaaaatagaaat |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5768605 |
tccaaatgctaattcacgttgtagaagaatacgaacaccaaaccataacttgcaagttgaatcaaaatagaaat |
5768532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University