View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5256-Insertion-7 (Length: 166)
Name: NF5256-Insertion-7
Description: NF5256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5256-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 5 - 166
Target Start/End: Complemental strand, 14131821 - 14131661
Alignment:
| Q |
5 |
caatatgagggtcttgtttatgttgaaataaatatgtttgtgtttagatgcccaatcaagttggaaagattgatacttgatgggctaaaatcaacgttta |
104 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14131821 |
caatatgagggtcttgttaatgttgaaataaatatgtttgtgtttagatgcccgatcaagttggaaagattgatacttgatgggctaaaatcaacgttta |
14131722 |
T |
|
| Q |
105 |
ctactcttttgttttggcattcctgtggagttgaagggtggatcttgaaaatcaaagttcat |
166 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
14131721 |
ctactcttttgttttggcattcct-tgaagttgaagggtgggtcttgaaaatcaaagttcat |
14131661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University