View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5256_low_17 (Length: 329)
Name: NF5256_low_17
Description: NF5256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5256_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 5915071 - 5914767
Alignment:
| Q |
18 |
atagtgtgtagtcccctccattttaggcactgttatttctcctataacatttcactttaaagatggatgtttcaaatcttcataagttgatgaagacagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5915071 |
atagtgtgtagtcccctccattttaggcactgttatttctcctataacatttcactttaaagatggatgtttcaaatcttcataagttggtgaagacagc |
5914972 |
T |
|
| Q |
118 |
accatccaaagctttgattatgagactcaatttgttatgtctttccatctttctcattgtttatgcaacccttcttcttcgtccttcttcttcggtctat |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5914971 |
accatccaaagctttgattatgagattcaatttgttatgtctttccatctttctcattgtttatgcaacccttcttcttcgtccttcttcttcagtctat |
5914872 |
T |
|
| Q |
218 |
ttcgataatgcagcctcgcttgttcgatgctcattgagagaatgccatcacaaggtaaggtgagcctattctaatggcatggcatccctttatcatcttc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5914871 |
ttcgataatgcagcctcgcttgttcgatgctcattgagagaatgccatcacaaggtaaggtgagcctattctaatggcatggcatccctttctcatcttc |
5914772 |
T |
|
| Q |
318 |
ctttg |
322 |
Q |
| |
|
|||| |
|
|
| T |
5914771 |
ttttg |
5914767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 5910685 - 5910417
Alignment:
| Q |
18 |
atagtgtgtagtcccctccattttaggcactgttatttctcctataacatttcactttaaagatggatgtttcaaatcttcataagttgatg---aagac |
114 |
Q |
| |
|
||||| || |||||||||||||| ||||||| ||||||| ||| ||||| ||||||||||||||||||||||||| || |||||||| || |||| |
|
|
| T |
5910685 |
atagtttgcagtcccctccattt-aggcactattatttcagcta--acattgcactttaaagatggatgtttcaaatgttaataagttgctggtgaagag |
5910589 |
T |
|
| Q |
115 |
agcaccatccaaagctttgattatgagactcaatttgttatgtctttccatctttctcattgtttatgcaacccttcttcttcgtccttcttcttcggtc |
214 |
Q |
| |
|
||||||||||||| ||||| | | || |||||||||| ||| || |||||||||| ||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
5910588 |
agcaccatccaaaactttggtggtccgattcaatttgttctgttttgccatctttctgattgtttatgcaacccttcttctccgtctgccttcttcggtc |
5910489 |
T |
|
| Q |
215 |
tatttcgataatgcagcctcgcttgttcgatgctcattgagagaatgccatcacaaggtaaggtgagcctat |
286 |
Q |
| |
|
||||| |||| ||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5910488 |
tattttgatagtgcagcctcacttgttggatgctctttgagagaatgccatcacaaggtaaggcgagcctat |
5910417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University