View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5256_low_20 (Length: 301)
Name: NF5256_low_20
Description: NF5256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5256_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 24689491 - 24689244
Alignment:
| Q |
18 |
acctttcaacaatggacttcaaactttatactcttgatctgtcattaacccatatgaggataattaggataactagtttagttagtctgaataccgttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24689491 |
acctttcaacaatggacttcaaactttatactcttgatctgtcattaacccatatgaggataattaggataactagtttagttagtctgaataccgttag |
24689392 |
T |
|
| Q |
118 |
ttagtcggatagcatattgttagcctttcctttcccttcnnnnnnnnnnnnctgtaatgaaaacaagagctatataacttagttctcaatgtattgtgtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24689391 |
ttagtcggatagcatattgttagcctttcctttcccttcttttttgtttttctgtaatgaaaacaagagctatataacttagttctcaatgtattgtgtt |
24689292 |
T |
|
| Q |
218 |
caattcgtagatctattcagttcatcttcttccccaaatcacaggttc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24689291 |
caattcgtagatctattcagttcatcttcttccccaaatcacaggttc |
24689244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University