View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5256_low_21 (Length: 292)
Name: NF5256_low_21
Description: NF5256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5256_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 36 - 201
Target Start/End: Original strand, 37046051 - 37046218
Alignment:
| Q |
36 |
ttcgtggttcaggttggttaaaa--ataatcaaatgtatctttgttgaccccagtatttggtccgaaaaactcaagttggagagctatcttagggtgcct |
133 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37046051 |
ttcgtggttcaggttggttaaaaaaataatcaaatgtatctttgttgaccccagtatttggtccgaaaaactcaagttggagagctatcttagggtgcct |
37046150 |
T |
 |
| Q |
134 |
accgacaatcatggagtccaattttatattatgatgcttcactaatcccatgtatcgtatcctatgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37046151 |
accgacaatcatggagtccaattttatattatgatggttcactaatcccatgtatcgtatcctatgat |
37046218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University