View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5256_low_26 (Length: 251)
Name: NF5256_low_26
Description: NF5256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5256_low_26 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 14132365 - 14132126
Alignment:
| Q |
11 |
cacagaaagcagtactagccagactggcctacaacgaaatctacttggaataggttgtatcatgc----cgtcaacttgatcagaaattggaaactagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14132365 |
cacagaaagcagtactagccagactggcctacaatgaaatctacttggaataggttgtatcatgcatgccgtcaacttgatcagaaattggaaactagaa |
14132266 |
T |
|
| Q |
107 |
atctatataaagtaattgttatttggttgtaataattttctagtaactttacaatatcgttacgttgatgtcccccaaaaggcacgtctcttccatgtac |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14132265 |
atctatataaagtaattgttttttggttgtaataattttctagtaactttacaatat-----cgttgatgtcccccaaaaggtacgtctcttccatgtac |
14132171 |
T |
|
| Q |
207 |
ttgcgcttgtcactagcaacacttattgataaagctgattttcat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14132170 |
ttgcgcttgtcactagcaacacttattgataaagctgattttcat |
14132126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University