View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5256_low_29 (Length: 237)
Name: NF5256_low_29
Description: NF5256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5256_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 112 - 222
Target Start/End: Complemental strand, 14131925 - 14131815
Alignment:
| Q |
112 |
ttatataaattgttaaaaagtttcaaatttcactattagtatttgagaaatgctaaatcattatattaccatactcaatgtagaaaacaaaaattattta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14131925 |
ttatataaattgttaaaaagtttcaaatttcactattagtatttgagaaatgctaaatcattatattaccatactcaatgtagaaaacaaaaattattta |
14131826 |
T |
 |
| Q |
212 |
atggcaatatg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
14131825 |
atggcaatatg |
14131815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 14132064 - 14131953
Alignment:
| Q |
1 |
caactaaaatactcagaaaagtgctatttctcgatgatgtgttcacaagaaatactattaatactattcgtgaagtcatcgtgatttttcagtcgcgatc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14132064 |
caacaaaaatactcagaaaagtgctatttctcgatgatgtgttcacaagaaatactattaatactattcgtgaagtcatcgtgatttttcagtcgcgatc |
14131965 |
T |
 |
| Q |
101 |
aatagcatggct |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14131964 |
aatagcatggct |
14131953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 79 - 112
Target Start/End: Complemental strand, 13343946 - 13343913
Alignment:
| Q |
79 |
tcgtgatttttcagtcgcgatcaatagcatggct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13343946 |
tcgtgatttttcagtcgcgatcaatagcatggct |
13343913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University