View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5256_low_9 (Length: 492)
Name: NF5256_low_9
Description: NF5256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5256_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 457; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 457; E-Value: 0
Query Start/End: Original strand, 17 - 477
Target Start/End: Complemental strand, 36147606 - 36147146
Alignment:
| Q |
17 |
cagcaatagcagccgatcttggaccagctgcagccttataaatcgctccggtaccaagcccagcaacagcactattaaccaaatcatccgtatccctaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147606 |
cagcaatagcagccgatcttggaccggctgcagccttataaatcgctccggtaccaagcccagcaacagcactattaaccaaatcatccgtatccctaaa |
36147507 |
T |
 |
| Q |
117 |
gtaagtcatcccactctccaatcccgcaaagatcaaccccaacacaccaagcgagtttccaagtctccgaccaccctgaccaccggagttaagaacacgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147506 |
gtaagtcatcccactctccaatcccgcaaagatcaaccccaacacaccaagcgagtttccaagtctccgaccaccctgaccaccggagttaagaacacgg |
36147407 |
T |
 |
| Q |
217 |
ttaacccgaagcttaacagattcacctgcctctgcctcccttaacccttgaacggttcctctggctccaccgatgatcgctccggagagataaccggtgc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147406 |
ttaacccgaagcttaacagattcacctgcctctgcctcccttaacccttgaacggttcctctggctccaccgatgatcgctccggagagataaccggtgc |
36147307 |
T |
 |
| Q |
317 |
cggtgtagtattgaacattttctccccatgaacggtgctttctgataatatcttcctggaagagatgttccggtgaagtggggaggttgtagagtttgtc |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147306 |
cggtgtagtattgaacattttctccccatgaacggtgctttctgataatatcttcctggaagagatgttccggtgaagtggggaggttgtagagtttgtc |
36147207 |
T |
 |
| Q |
417 |
aatggggacgttgttgaggtgttggtagggatggtagagacgtgtgttttggtgatctttt |
477 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36147206 |
aatggggacgttgttgaggtgttggtagggatggtagagacgtgtgttttggtgatctttt |
36147146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University